MPUSP/snakemake-bacterial-riboseq
Bacterial-Riboseq: A Snakemake workflow for the analysis of riboseq data in bacteria.
Overview
Latest release: v1.6.0, Last update: 2026-04-07
Share link: https://snakemake.github.io/snakemake-workflow-catalog?wf=MPUSP/snakemake-bacterial-riboseq
Quality control: linting: passed formatting: passed
Topics: bioinformatics-pipeline conda riboseq ribosome-profiling singularity snakemake workflow
Wrappers: bio/cutadapt/se bio/fastqc
Workflow Rule Graph
This visualization of the workflow’s rule graph was automatically generated using Snakevision
Deployment
Step 1: Install Snakemake and Snakedeploy
Snakemake and Snakedeploy are best installed via the Conda package manager. It is recommended to install conda via Miniforge. Run
conda create -c conda-forge -c bioconda -c nodefaults --name snakemake snakemake snakedeploy
to install both Snakemake and Snakedeploy in an isolated environment. For all following commands ensure that this environment is activated via
conda activate snakemake
For other installation methods, refer to the Snakemake and Snakedeploy documentation.
Step 2: Deploy workflow
With Snakemake and Snakedeploy installed, the workflow can be deployed as follows. First, create an appropriate project working directory on your system and enter it:
mkdir -p path/to/project-workdir
cd path/to/project-workdir
In all following steps, we will assume that you are inside of that directory. Then run
snakedeploy deploy-workflow https://github.com/MPUSP/snakemake-bacterial-riboseq . --tag v1.6.0
Snakedeploy will create two folders, workflow and config. The former contains the deployment of the chosen workflow as a Snakemake module, the latter contains configuration files which will be modified in the next step in order to configure the workflow to your needs.
Step 3: Configure workflow
To configure the workflow, adapt config/config.yml to your needs following the instructions below.
Step 4: Run workflow
The deployment method is controlled using the --software-deployment-method (short --sdm) argument.
To run the workflow with automatic deployment of all required software via conda/mamba, use
snakemake --cores all --sdm conda
To run the workflow using a combination of conda and apptainer/singularity for software deployment, use
snakemake --cores all --sdm conda apptainer
Snakemake will automatically detect the main Snakefile in the workflow subfolder and execute the workflow module that has been defined by the deployment in step 2.
For further options such as cluster and cloud execution, see the docs.
Step 5: Generate report
After finalizing your data analysis, you can automatically generate an interactive visual HTML report for inspection of results together with parameters and code inside of the browser using
snakemake --report report.zip
Configuration
The following section is imported from the workflow’s config/README.md.
Running the workflow
Input data
Reference genome
An NCBI Refseq ID, e.g. GCF_000006945.2. Find your genome assembly and corresponding ID on NCBI genomes. Alternatively use a custom pair of *.fasta file and *.gff file that describe the genome of choice.
Important requirements when using custom *.fasta and *.gff files:
*.gffgenome annotation must have the same chromosome/region name as the*.fastafile (example:NC_003197.2)*.gffgenome annotation must havegeneandCDStype annotation that is automatically parsed to extract transcriptsall chromosomes/regions in the
*.gffgenome annotation must be present in the*.fastasequencebut not all sequences in the
*.fastafile need to have annotated genes in the*.gfffile
Read data
Ribosome footprint sequencing data in *.fastq.gz format. The currently supported input data are single-end, strand-specific reads. Input data files are supplied via a mandatory table, whose location is indicated in the config.yml file (default: samples.tsv). The sample sheet has the following layout:
sample |
condition |
replicate |
fq1 |
|---|---|---|---|
RPF-RTP1 |
RPF-RTP |
1 |
data/RPF-RTP1_R1_001.fastq.gz |
RPF-RTP2 |
RPF-RTP |
2 |
data/RPF-RTP2_R1_001.fastq.gz |
Some configuration parameters of the pipeline may be specific for your data and library preparation protocol. The options should be adjusted in the config.yml file. For example:
Minimum and maximum read length after adapter removal (see option
cutadapt: default). Here, the test data has a minimum read length of 15 + 7 = 22 (2 nt on 5’end + 5 nt on 3’end), and a maximum of 45 + 7 = 52.Unique molecular identifiers (UMIs). For example, the protocol by McGlincy & Ingolia, 2017 creates a UMI that is located on both the 5’-end (2 nt) and the 3’-end (5 nt). These UMIs are extracted with
umi_tools(see optionsumi_extraction: methodandpattern).
Example configuration files for different sequencing protocols can be found in resources/protocols/.
Workflow parameters
The following table is automatically parsed from the workflow’s config.schema.y(a)ml file.
Parameter |
Type |
Description |
Required |
Default |
|---|---|---|---|---|
samplesheet |
string |
path to samplesheet, mandatory |
yes |
config/samples.tsv |
get_genome |
reference genome source and files |
yes |
||
. database |
[‘string’, ‘null’] |
one of |
ncbi |
|
. assembly |
[‘string’, ‘null’] |
RefSeq ID |
GCF_000006785.2 |
|
. fasta |
[‘string’, ‘null’] |
optional path to fasta file |
||
. gff |
[‘string’, ‘null’] |
optional path to gff file |
||
. gff_source_type |
array |
list of name/value pairs for GFF source |
||
cutadapt |
adapter trimming parameters |
yes |
||
. adapters |
string |
sequence of 5’ (-g) / 3’ (-a) adapter |
-a ATCGTAGATCGGAAGAGCACACGTCTGAA |
|
. default |
array |
additional options passed to cutadapt |
[‘-q 10 ‘, ‘-m 22 ‘, ‘-M 52’, ‘–overlap=3’] |
|
umi_extraction |
UMI extraction settings |
yes |
||
. method |
string |
one of |
regex |
|
. pattern |
string |
string or regular expression |
^(?P<umi_0>.{5}).*(?P<umi_1>.{2})$ |
|
umi_dedup |
array |
default options for deduplication |
yes |
|
star |
STAR alignment settings |
yes |
||
. index |
[‘string’, ‘null’] |
location of genome index; if Null, is made |
||
. genomeSAindexNbases |
number |
length of pre-indexing string, see STAR man |
9 |
|
. multi |
number |
max number of loci read is allowed to map |
10 |
|
. sam_multi |
number |
max number of alignments reported for read |
1 |
|
. intron_max |
number |
max length of intron; 0 = automatic choice |
1 |
|
. default |
array |
default options for STAR aligner |
||
extract_features |
feature extraction and filtering |
yes |
||
. biotypes |
array |
biotypes to exclude from mapping |
[‘rRNA’, ‘tRNA’] |
|
. CDS |
array |
CDS type to include for mapping |
[‘protein_coding’] |
|
bedtools_intersect |
bedtools intersect options |
yes |
||
. defaults |
array |
remove hits, sense strand, min overlap 20% |
[‘-v ‘, ‘-s ‘, ‘-f 0.2’] |
|
annotate_orfs |
ORF annotation settings |
yes |
||
. window_size |
number |
size of 5’-UTR added to CDS |
30 |
|
shift_reads |
read shifting parameters |
yes |
||
. window_size |
number |
start codon window to determine shift |
30 |
|
. read_length |
array |
size range of reads to use for shifting |
[27, 45] |
|
. end_alignment |
string |
end used for alignment of RiboSeq reads |
3prime |
|
. shift_table |
[‘string’, ‘null’] |
optional table with offsets per read length |
||
. export_bigwig |
boolean |
export shifted reads as bam file |
true |
|
. export_ofst |
boolean |
export shifted reads as ofst file |
false |
|
. skip_shifting |
boolean |
skip read shifting entirely |
false |
|
. skip_length_filter |
boolean |
skip filtering reads by length |
false |
|
multiqc |
MultiQC reporting parameters |
yes |
||
. fastqc_stage |
string |
|||
. config |
string |
path to multiqc config |
config/multiqc_config.yml |
|
report |
report rendering parameters |
yes |
||
. export_figures |
boolean |
export figures as .svg and .png |
true |
|
. export_dir |
string |
sub-directory for figure export |
figures/ |
|
. figure_width |
number |
standard figure width in px |
875 |
|
. figure_height |
number |
standard figure height in px |
500 |
|
. figure_resolution |
number |
standard figure resolution in dpi |
125 |
Linting and formatting
Linting results
All tests passed!
Formatting results
All tests passed!