MPUSP/snakemake-bacterial-riboseq

Bacterial-Riboseq: A Snakemake workflow for the analysis of riboseq data in bacteria.

Overview

Latest release: v1.4.0, Last update: 2025-02-02

Linting: linting: passed, Formatting: formatting: passed

Topics: bioinformatics-pipeline conda riboseq ribosome-profiling singularity snakemake workflow

Deployment

Step 1: Install Snakemake and Snakedeploy

Snakemake and Snakedeploy are best installed via the Conda. It is recommended to install conda via Miniforge. Run

conda create -c conda-forge -c bioconda -c nodefaults --name snakemake snakemake snakedeploy

to install both Snakemake and Snakedeploy in an isolated environment. For all following commands ensure that this environment is activated via

conda activate snakemake

For other installation methods, refer to the Snakemake and Snakedeploy documentation.

Step 2: Deploy workflow

With Snakemake and Snakedeploy installed, the workflow can be deployed as follows. First, create an appropriate project working directory on your system and enter it:

mkdir -p path/to/project-workdir
cd path/to/project-workdir

In all following steps, we will assume that you are inside of that directory. Then run

snakedeploy deploy-workflow https://github.com/MPUSP/snakemake-bacterial-riboseq . --tag v1.4.0

Snakedeploy will create two folders, workflow and config. The former contains the deployment of the chosen workflow as a Snakemake module, the latter contains configuration files which will be modified in the next step in order to configure the workflow to your needs.

Step 3: Configure workflow

To configure the workflow, adapt config/config.yml to your needs following the instructions below.

Step 4: Run workflow

The deployment method is controlled using the --software-deployment-method (short --sdm) argument.

To run the workflow with automatic deployment of all required software via conda/mamba, use

snakemake --cores all --sdm conda

To run the workflow using a combination of conda and apptainer/singularity for software deployment, use

snakemake --cores all --sdm conda apptainer

Snakemake will automatically detect the main Snakefile in the workflow subfolder and execute the workflow module that has been defined by the deployment in step 2.

For further options such as cluster and cloud execution, see the docs.

Step 5: Generate report

After finalizing your data analysis, you can automatically generate an interactive visual HTML report for inspection of results together with parameters and code inside of the browser using

snakemake --report report.zip

Configuration

The following section is imported from the workflow’s config/README.md.

snakemake-bacterial-riboseq

Usage

The usage of this workflow is described in the Snakemake Workflow Catalog.

If you use this workflow in a paper, don't forget to give credits to the authors by citing the URL of this (original) repository and its DOI (see above).

Workflow overview

This workflow is a best-practice workflow for the analysis of ribosome footprint sequencing (Ribo-Seq) data. The workflow is built using snakemake and consists of the following steps:

  1. Obtain genome database in fasta and gff format (python, NCBI Datasets)
    1. Using automatic download from NCBI with a RefSeq ID
    2. Using user-supplied files
  2. Check quality of input sequencing data (FastQC)
  3. Cut adapters and filter by length and/or sequencing quality score (cutadapt)
  4. Deduplicate reads by unique molecular identifier (UMI, umi_tools)
  5. Map reads to the reference genome (STAR aligner)
  6. Sort and index for aligned seq data (samtools)
  7. Filter reads by feature type (bedtools)
  8. Generate summary report for all processing steps (MultiQC)
  9. Shift ribo-seq reads according to the ribosome's P-site alignment (R, ORFik)
  10. Calculate basic gene-wise statistics such as RPKM (R, ORFik)
  11. Return report as HTML and PDF files (R markdown, weasyprint)

If you want to contribute, report issues, or suggest features, please get in touch on github.

Installation

Step 1: Clone this repository

git clone https://github.com/MPUSP/snakemake-bacterial-riboseq.git
cd snakemake-bacterial-riboseq

Step 2: Install dependencies

It is recommended to install snakemake and run the workflow with conda, mamba or micromamba.

# download Miniconda3 installer
wget https://repo.continuum.io/miniconda/Miniconda3-latest-Linux-x86_64.sh -O miniconda.sh
# install Conda (respond by 'yes')
bash miniconda.sh
# update Conda
conda update -y conda
# install Mamba
conda install -n base -c conda-forge -y mamba

Step 3: Create snakemake environment

This step creates a new conda environment called snakemake-bacterial-riboseq.

# create new environment with dependencies & activate it
mamba create -c conda-forge -c bioconda -n snakemake-bacterial-riboseq snakemake pandas
conda activate snakemake-bacterial-riboseq

Note:

All other dependencies for the workflow are automatically pulled as conda environments by snakemake, when running the workflow with the --use-conda parameter (recommended).

Running the workflow

Input data

Reference genome

An NCBI Refseq ID, e.g. GCF_000006945.2. Find your genome assembly and corresponding ID on NCBI genomes. Alternatively use a custom pair of *.fasta file and *.gff file that describe the genome of choice.

Important requirements when using custom *.fasta and *.gff files:

  • *.gff genome annotation must have the same chromosome/region name as the *.fasta file (example: NC_003197.2)
  • *.gff genome annotation must have gene and CDS type annotation that is automatically parsed to extract transcripts
  • all chromosomes/regions in the *.gff genome annotation must be present in the *.fasta sequence
  • but not all sequences in the *.fasta file need to have annotated genes in the *.gff file

Read data

Ribosome footprint sequencing data in *.fastq.gz format. The currently supported input data are single-end, strand-specific reads. Input data files are supplied via a mandatory table, whose location is indicated in the config.yml file (default: samples.tsv). The sample sheet has the following layout:

sample condition replicate data_folder fq1
RPF-RTP1 RPF-RTP 1 data RPF-RTP1_R1_001.fastq.gz
RPF-RTP2 RPF-RTP 2 data RPF-RTP2_R1_001.fastq.gz

Some configuration parameters of the pipeline may be specific for your data and library preparation protocol. The options should be adjusted in the config.yml file. For example:

  • Minimum and maximum read length after adapter removal (see option cutadapt: default). Here, the test data has a minimum read length of 15 + 7 = 22 (2 nt on 5'end + 5 nt on 3'end), and a maximum of 45 + 7 = 52.
  • Unique molecular identifiers (UMIs). For example, the protocol by McGlincy & Ingolia, 2017 creates a UMI that is located on both the 5'-end (2 nt) and the 3'-end (5 nt). These UMIs are extracted with umi_tools (see options umi_extraction: method and pattern).

Example configuration files for different sequencing protocols can be found in resources/protocols/.

Execution

To run the workflow from command line, change the working directory.

cd path/to/snakemake-bacterial-riboseq

Adjust options in the default config file config/config.yml. Before running the entire workflow, you can perform a dry run using:

snakemake --dry-run

To run the complete workflow with test files using conda, execute the following command. The definition of the number of compute cores is mandatory.

snakemake --cores 10 --use-conda --directory .test

Parameters

This table lists all parameters that can be used to run the workflow.

parameter type details default
samplesheet
path str path to samplesheet, mandatory "config/samples.tsv"
get_genome
database str one of manual, ncbi ncbi
assembly str RefSeq ID GCF_000006785.2
fasta str optional path to fasta file Null
gff str optional path to gff file Null
gff_source_type str list of name/value pairs for GFF source see config file
cutadapt
fivep_adapter str sequence of the 5' adapter Null
threep_adapter str sequence of the 3' adapter ATCGTAGATCGGAAGAGCACACGTCTGAA
default str additional options passed to cutadapt [-q 10 , -m 22 , -M 52, --overlap=3]
umi_extraction
method str one of string or regex, see manual regex
pattern str string or regular expression ^(?P<umi_0>.{5}).*(?P<umi_1>.{2})$
umi_dedup
options str default options for deduplication see config file
star
index str location of genome index; if Null, is made Null
genomeSAindexNbases num length of pre-indexing string, see STAR man 9
multi num max number of loci read is allowed to map 10
sam_multi num max number of alignments reported for read 1
intron_max num max length of intron; 0 = automatic choice 1
default str default options for STAR aligner see config file
extract_features
biotypes str biotypes to exclude from mapping [rRNA, tRNA]
CDS str CDS type to include for mapping [protein_coding]
bedtools_intersect
defaults str remove hits, sense strand, min overlap 20% [-v , -s , -f 0.2]
annotate_orfs
window_size num size of 5'-UTR added to CDS 30
shift_reads
window_size num start codon window to determine shift 30
read_length num size range of reads to use for shifting [27, 45]
end_alignment str end used for alignment of RiboSeq reads 3prime
shift_table str optional table with offsets per read length Null
export_bigwig str export shifted reads as bam file True
export_ofst str export shifted reads as ofst file False
skip_shifting str skip read shifting entirely False
skip_length_filter str skip filtering reads by length False
multiqc
config str path to multiqc config config/multiqc_config.yml
report
export_figures bool export figures as .svg and .png True
export_dir str sub-directory for figure export figures/
figure_width num standard figure width in px 875
figure_height num standard figure height in px 500
figure_resolution num standard figure resolution in dpi 125

Linting and formatting

Linting results

All tests passed!

Formatting results

All tests passed!