b-brankovics/smkwf-oligo-screening
Snakemake workflow for screening olignucleotide anealing sites and identifying PCR amplicon regions
Overview
Latest release: None, Last update: 2026-09-21
Share link: https://snakemake.github.io/snakemake-workflow-catalog?wf=b-brankovics/smkwf-oligo-screening
Quality control: linting: passed formatting: passed
Wrappers: bio/last/lastal bio/last/lastdb bio/picard/createsequencedictionary
Workflow Rule Graph
This visualization of the workflow’s rule graph was automatically generated using Snakevision
Deployment
Step 1: Install Snakemake and Snakedeploy
Snakemake and Snakedeploy are best installed via the Conda package manager. It is recommended to install conda via Miniforge. Run
conda create -c conda-forge -c bioconda -c nodefaults --name snakemake snakemake snakedeploy
to install both Snakemake and Snakedeploy in an isolated environment. For all following commands ensure that this environment is activated via
conda activate snakemake
For other installation methods, refer to the Snakemake and Snakedeploy documentation.
Step 2: Deploy workflow
With Snakemake and Snakedeploy installed, the workflow can be deployed as follows. First, create an appropriate project working directory on your system and enter it:
mkdir -p path/to/project-workdir
cd path/to/project-workdir
In all following steps, we will assume that you are inside of that directory. Then run
snakedeploy deploy-workflow https://github.com/b-brankovics/smkwf-oligo-screening . --tag None
Snakedeploy will create two folders, workflow and config. The former contains the deployment of the chosen workflow as a Snakemake module, the latter contains configuration files which will be modified in the next step in order to configure the workflow to your needs.
Step 3: Configure workflow
To configure the workflow, adapt config/config.yml to your needs following the instructions below.
Step 4: Run workflow
The deployment method is controlled using the --software-deployment-method (short --sdm) argument.
To run the workflow using a combination of conda and apptainer/singularity for software deployment, use
snakemake --cores all --sdm conda apptainer
To run the workflow with automatic deployment of all required software via conda/mamba, use
snakemake --cores all --sdm conda
Snakemake will automatically detect the main Snakefile in the workflow subfolder and execute the workflow module that has been defined by the deployment in step 2.
For further options such as cluster and cloud execution, see the docs.
Step 5: Generate report
After finalizing your data analysis, you can automatically generate an interactive visual HTML report for inspection of results together with parameters and code inside of the browser using
snakemake --report report.zip
Configuration
The following section is imported from the workflow’s config/README.md.
Workflow overview
This workflow extracts PCR amplicon regions from genomes. The workflow is built using snakemake and consists of the following steps:
Need to update
Running the workflow
Input data
This workflow extracts PCR amplicon regions from genomes, and then can process them for STR typing. You need to specify four tables (TSVs) and a yaml file (primers.yaml) as inputs:
accessions.tsv:
sample |
assembly |
|---|---|
Af293 |
GCF_000002655.1 |
A1160 |
GCA_024220425.1 |
W72310 |
GCA_040167795.1 |
ATCC46645 |
GCA_040142955.1 |
local.tsv:
sample |
assembly_file |
|---|---|
sample1 |
data/genomes/sample1_contigs.fasta |
sample2 |
data/genomes/sample2_contigs.fasta |
sample3 |
data/genomes/sample3_contigs.fasta |
primers.tsv:
Locus |
Description |
Name |
Sequence |
OligoType |
Reference |
|---|---|---|---|---|---|
ITS |
Internal Transcribed Spacer |
ITS5 |
GGAAGTAAAAGTCGTAACAAGG |
F |
DOI:10.1017/S0953756297005881 |
ITS |
Internal Transcribed Spacer |
ITS4 |
TCCTCCGCTTATTGATATGC |
R |
White et al. (1990) |
LSU |
Large subunit ribosomal ribonucleic acid |
LROR |
ACCCGCTGAACTTAAGC |
F |
Vilgalys & Hester (1990) |
LSU |
Large subunit ribosomal ribonucleic acid |
LR5 |
TCCTGAGGGAAACTTCG |
R |
Vilgalys & Hester (1990) |
BenA |
Beta tubulin |
Bt2a |
GGTAACCAAATCGGTGCTGCTTTC |
F |
DOI:10.1128/aem.61.4.1323-1330.1995 |
BenA |
Beta tubulin |
Bt2b |
ACCCTCAGTGTAGTGACCCTTGGC |
R |
DOI:10.1128/aem.61.4.1323-1330.1995 |
CaM |
Calmodulin |
cmd5 |
CCGAGTACAAGGAGGCCTTC |
F |
DOI:10.1080/15572536.2006.11832738 |
CaM |
Calmodulin |
cmd6 |
CCGATAGAGGTCATAACGTGG |
R |
DOI:10.1080/15572536.2006.11832738 |
Act |
nuclear actin |
ACT-512F |
ATGTGCAAGGCCGGTTTCGC |
F |
DOI:10.1080/00275514.1999.12061051 |
Act |
nuclear actin |
ACT-783R |
TACGAGTCCTTCTGGCCCAT |
R |
DOI:10.1080/00275514.1999.12061051 |
rodA |
hydrophobin |
rodA1 |
GCTGGCAATGGTGTTGGCAA |
F |
DOI:10.1080/00275514.1998.12026977 |
rodA |
hydrophobin |
rodA2 |
AGGGCAATGCAAGGAAGACC |
R |
DOI:10.1080/00275514.1998.12026977 |
CYP51A |
Erg11 or Cyp51A |
cyp51_F |
CGGCCGGATGGACATCT |
F |
DOI:10.1128/jcm.00604-19 |
CYP51A |
Erg11 or Cyp51A |
cyp51_R |
GCTCGAGCAGCGGTAAAAAT |
R |
DOI:10.1128/jcm.00604-19 |
CYP51A |
Erg11 or Cyp51A |
cyp51_LST |
CAATGGCTGAGATTAC |
P |
DOI:10.1128/jcm.00604-19 |
Parameters
This table lists all parameters that can be used to run the workflow.
parameter |
type |
details |
default |
|---|---|---|---|
accessions |
path |
path to sample sheet of accessions, mandatory |
“config/accessions.tsv” |
local_samples |
path |
path to sample sheet of local assemblies, mandatory |
“config/local.tsv” |
Workflow parameters
The following table is automatically parsed from the workflow’s config.schema.y(a)ml file.
Parameter |
Type |
Description |
Required |
Default |
|---|---|---|---|---|
accessions |
string |
path to sample-sheet for accessions TSV file |
yes |
|
local_samples |
string |
path to sample-sheet for local assemblies TSV file |
yes |
|
primers |
string |
path to sample-sheet for primers TSV file |
yes |
|
filtering |
parameters for filtering amplicons |
yes |
||
. min_amplicon_length |
integer |
minimum length of amplicon to keep |
yes |
|
. max_amplicon_length |
integer |
maximum length of amplicon to keep |
yes |
|
. max_total_mismatches |
integer |
maximum number of total mismatches allowed for the oligos combined |
yes |
|
. reject_primer_from |
integer |
minimum number mismatches per oligo that will reject the amplicon |
yes |
Linting and formatting
Linting results
All tests passed!
Formatting results
All tests passed!