b-brankovics/smkwf-oligo-screening

Snakemake workflow for screening olignucleotide anealing sites and identifying PCR amplicon regions

Overview

Latest release: None, Last update: 2026-07-08

Share link: https://snakemake.github.io/snakemake-workflow-catalog?wf=b-brankovics/smkwf-oligo-screening

Quality control: linting: passed formatting: passed

Wrappers: bio/last/lastal bio/last/lastdb bio/picard/createsequencedictionary

Workflow Rule Graph

This visualization of the workflow’s rule graph was automatically generated using Snakevision

Deployment

Step 1: Install Snakemake and Snakedeploy

Snakemake and Snakedeploy are best installed via the Conda package manager. It is recommended to install conda via Miniforge. Run

conda create -c conda-forge -c bioconda -c nodefaults --name snakemake snakemake snakedeploy

to install both Snakemake and Snakedeploy in an isolated environment. For all following commands ensure that this environment is activated via

conda activate snakemake

For other installation methods, refer to the Snakemake and Snakedeploy documentation.

Step 2: Deploy workflow

With Snakemake and Snakedeploy installed, the workflow can be deployed as follows. First, create an appropriate project working directory on your system and enter it:

mkdir -p path/to/project-workdir
cd path/to/project-workdir

In all following steps, we will assume that you are inside of that directory. Then run

snakedeploy deploy-workflow https://github.com/b-brankovics/smkwf-oligo-screening . --tag None

Snakedeploy will create two folders, workflow and config. The former contains the deployment of the chosen workflow as a Snakemake module, the latter contains configuration files which will be modified in the next step in order to configure the workflow to your needs.

Step 4: Run workflow

The deployment method is controlled using the --software-deployment-method (short --sdm) argument.

To run the workflow using a combination of conda and apptainer/singularity for software deployment, use

snakemake --cores all --sdm conda apptainer

To run the workflow with automatic deployment of all required software via conda/mamba, use

snakemake --cores all --sdm conda

Snakemake will automatically detect the main Snakefile in the workflow subfolder and execute the workflow module that has been defined by the deployment in step 2.

For further options such as cluster and cloud execution, see the docs.

Step 5: Generate report

After finalizing your data analysis, you can automatically generate an interactive visual HTML report for inspection of results together with parameters and code inside of the browser using

snakemake --report report.zip

Configuration

The following section is imported from the workflow’s config/README.md.

Workflow overview

This workflow extracts PCR amplicon regions from genomes. The workflow is built using snakemake and consists of the following steps:

Need to update

Running the workflow

Input data

This workflow extracts PCR amplicon regions from genomes, and then can process them for STR typing. You need to specify four tables (TSVs) and a yaml file (primers.yaml) as inputs:

accessions.tsv:

sample	assembly
Af293	GCF_000002655.1
A1160	GCA_024220425.1
W72310	GCA_040167795.1
ATCC46645	GCA_040142955.1

local.tsv:

sample	assembly_file
sample1	data/genomes/sample1_contigs.fasta
sample2	data/genomes/sample2_contigs.fasta
sample3	data/genomes/sample3_contigs.fasta

primers.tsv:

Locus	Description	Name	Sequence	OligoType	Reference
ITS	Internal Transcribed Spacer	ITS5	GGAAGTAAAAGTCGTAACAAGG	F	DOI:10.1017/S0953756297005881
ITS	Internal Transcribed Spacer	ITS4	TCCTCCGCTTATTGATATGC	R	White et al. (1990)
LSU	Large subunit ribosomal ribonucleic acid	LROR	ACCCGCTGAACTTAAGC	F	Vilgalys & Hester (1990)
LSU	Large subunit ribosomal ribonucleic acid	LR5	TCCTGAGGGAAACTTCG	R	Vilgalys & Hester (1990)
BenA	Beta tubulin	Bt2a	GGTAACCAAATCGGTGCTGCTTTC	F	DOI:10.1128/aem.61.4.1323-1330.1995
BenA	Beta tubulin	Bt2b	ACCCTCAGTGTAGTGACCCTTGGC	R	DOI:10.1128/aem.61.4.1323-1330.1995
CaM	Calmodulin	cmd5	CCGAGTACAAGGAGGCCTTC	F	DOI:10.1080/15572536.2006.11832738
CaM	Calmodulin	cmd6	CCGATAGAGGTCATAACGTGG	R	DOI:10.1080/15572536.2006.11832738
Act	nuclear actin	ACT-512F	ATGTGCAAGGCCGGTTTCGC	F	DOI:10.1080/00275514.1999.12061051
Act	nuclear actin	ACT-783R	TACGAGTCCTTCTGGCCCAT	R	DOI:10.1080/00275514.1999.12061051
rodA	hydrophobin	rodA1	GCTGGCAATGGTGTTGGCAA	F	DOI:10.1080/00275514.1998.12026977
rodA	hydrophobin	rodA2	AGGGCAATGCAAGGAAGACC	R	DOI:10.1080/00275514.1998.12026977
CYP51A	Erg11 or Cyp51A	cyp51_F	CGGCCGGATGGACATCT	F	DOI:10.1128/jcm.00604-19
CYP51A	Erg11 or Cyp51A	cyp51_R	GCTCGAGCAGCGGTAAAAAT	R	DOI:10.1128/jcm.00604-19
CYP51A	Erg11 or Cyp51A	cyp51_LST	CAATGGCTGAGATTAC	P	DOI:10.1128/jcm.00604-19

Parameters

This table lists all parameters that can be used to run the workflow.

parameter	type	details	default
accessions	path	path to sample sheet of accessions, mandatory	“config/accessions.tsv”
local_samples	path	path to sample sheet of local assemblies, mandatory	“config/local.tsv”

Workflow parameters

The following table is automatically parsed from the workflow’s config.schema.y(a)ml file.

Parameter	Type	Description	Required	Default
accessions	string	path to sample-sheet for accessions TSV file	yes
local_samples	string	path to sample-sheet for local assemblies TSV file	yes